Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern
DOI:
https://doi.org/10.3329/ajmbr.v5i3.43591Keywords:
antimicrobial resistance; Salmonella enterica; virulence gene; turkey; internal organsAbstract
Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans.
Asian J. Med. Biol. Res. June 2019, 5(3): 219-225
Downloads
386
291
Downloads
Published
How to Cite
Issue
Section
License
Authors who publish with this journal agree to the following terms / The author(s) affirm(s) that:
- The manuscript submitted is based on authors own research and is original work.
- Authors certify that we all participated in the research work and preparation of the manuscript in a substantive way.
- Authors also declare that they have read and approved the manuscript.
- Authors further declare that the manuscript has not been published in part or full and is not being submitted or considered for publication in part or full elsewhere.
- Any material included in the manuscript does not violate copyright or other rights of anyone.
- Authors also affirm that the article contains no vilifying or unlawful statements and does not contain material or instructions that might cause harm or injury to the Editor-in-Chief/Editors of the Journal and the public.
- Authors assure Asian J. Med. Biol. Res. and the Editor-in-Chief/Editors of the Journals, and hold them harmless from any loss, expense or damage occurred by a claim or suit by a third party for copyright violation, or any suit arising out of any violation of the foregoing warranties as a result of publication of my/our article.
- In consideration of authors manuscript submitted, authors hereby grant Asian J. Med. Biol. Res. unlimited, worldwide, permanent royalty-free, right to publish, use, dispense, license, transmit, display, exhibit, record, store, translate, digitize, broadcast, reproduce and archive, in any format or medium, whether now known or developed hereafter.
All materials related to manuscripts, accepted or rejected, including photographs, original figures etc., will be kept by Asian J. Med. Biol. Res. for one year following the editors decision. These materials will then be destroyed.
